circad | circRNAs associated with diseases

circRNA_100290/hsa_circ_0013339/hsa_circ_100290
Gene	SLC30A7	Organism	Human
Genome Locus	chr1:101372407-101379362:+	Build	hg19
Disease	Oral Squamous Cell Carcinoma	ICD-10	Carcinoma in situ of oral cavity, oesophagus and stomach (D00)
DBLink	Link to database	PMID	28368401
Experimental Method
Sample Type	Tissues	Comparison	Oral Squamous Cell Carcinoma (OSCC) tissue and paired non-cancerous matched tissue
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTCATTCCCTCTTTAATGGTG Reverse CAGAACTTCCGCTCTAACATAC	Statistics	Fold Change : Upregulated,6.9112928. pvalue : p=0.000011097
Citation
Chen, L, Zhang, S, Wu, J, Cui, J, Zhong, L, Zeng, L, Ge, S (2017). circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family. Oncogene, 36, 32:4551-4561.